Western blot analysis of the input and pull-down samples demonstrated that this resin was able to retain most of the eIF4E protein present in the extract (Physique 6A, bottom panel). a major step in gene Nevanimibe hydrochloride expression regulation. Initiation of translation in eukaryotes is the rate-limiting step of protein synthesis and involves a set of specialized proteins known as initiation factors (eIFs) that recruit the small ribosome subunit to the m7GTP residue (or cap), located at the 5-end of most mRNAs (1). The cap-dependent initiation complex scans along the 5 untranslated regions (UTR) until an AUG codon placed in the appropriate context is recognized by the translation machinery to start protein synthesis (2). Not surprisingly, the 5 UTR of mRNAs, in concerted action with the 3 UTR, play a key role in this process serving as platforms for the formation of macromolecular complexes controlling translation initiation. In contrast to the general cap-dependent mechanism of translation initiation, some cytoplasmic RNA viruses, such as picornaviruses, initiate translation internally (3,4), independently of the 5-end and bypassing stable RNA structures present on their 5 UTRs and proteins bound to it. Internal initiation of translation in eukaryotic cells is usually mediated bycis-acting RNA structures termed internal ribosome entry site (IRES) elements that recruit the translational machinery to an internal position in the mRNA of some viruses (5) and a specific subset of cellular mRNAs (6,7). However, because of the lack of conservation at the level of Nevanimibe hydrochloride primary sequence, RNA structure and transacting factor requirements, the general principles governing internal initiation of translation are still poorly comprehended. Picornavirus IRES activity relies on the conversation with cellular proteins including translation eIFs and IREStrans-acting factors (ITAFs) (8). Hepatitis C computer virus (HCV) RNA also initiates translation using a cap-independent mechanism (9,10). Despite performing a similar function, HCV and picornavirus IRES elements differ in primary sequence, RNA structure and ITAFs requirement (11). Most ITAFs are RNA-binding proteins that regulate RNA life-spam as part of macromolecular complexes operating either in the nucleus or in the cytoplasm of the cell (12). Some of these factors travel with the RNA and are responsible for the establishment and regulation of complex RNAprotein networks that determine the fate of the target mRNA (13). To gain insights Nevanimibe hydrochloride into the mechanism of internal translation initiation, we compared the proteins associated with two unrelated viral IRES elements. We report that two ITAFs with an apparent mobility of 170 kDa correspond to eIF3a and Gemin5. The conversation with foot-and-mouth disease computer virus (FMDV) and HCV IRES elements is direct and sequence-specific. We also found that Gemin5 forms an RNA-independent protein complex with eIF4E. Functional analysis addressing the role of Gemin5 showed that this IRES-binding factor down-regulated IRES activity. Furthermore, Gemin5 also negatively affected cap-dependent initiation, suggesting that this protein acts as a general down-regulator of translation. == MATERIALS AND METHODS == == Constructs == Plasmids expressing different domains of FMDV and HCV IRES elements have been already described (14). The dicistronic constructs CMVpBIC and CMVp156, bearing either the FMDV or the HCV IRES upstream of the luciferase coding region, were constructed by transferring theMluI-bluntNotI fragment from pBIC-AvrII-Not (15) into theNheI-bluntNotI pCDNA3 vector. The Gemin5 (pSUPER-GFP-Gemin5) or the polypyrimidine (PTB) silencing plasmids (pSUPER-GFP-PTB) [target sequences GCAUAGUGGUGAUAAUUGA (16) or AACTTCCATCATTCCAGAGAA (17), respectively], were generated according to the manufacturer instructions (OligoEngine). The control shRNA expressed from pSUPER-GFP-TM (18) (target sequence AATTCTCCGAACGTGTCACGT) had no homology to any mammalian gene. == RNA synthesis == T7 transcription was performed at 37C for 1 h using the Megashortscript kit (Ambion) as recommended by the manufacturer. When needed, transcripts were uniformly labeled using 32P-CTP (400 Rabbit Polyclonal to ENDOGL1 Ci/mmol). DNA template was digested with 1 U of RQ1 DNase (Promega) and unincorporated 32P-CTP eliminated by exclusion chromatography (19). RNA was extracted with phenolchloroform, ethanol precipitated and.
Categories:EP1-4 Receptors